Animals
Unless otherwise indicated, 8–12-week-old C57BL/6J mice (The Jackson Laboratory), Igfbp2–/– mice (a kind gift from Dr. Clifford J. Rosen), and Ncf11–/– mice (Taconic) were used in this study. Ncf11–/– mice were back crossed to C57BL/6J mice for at least 10 generations, in house, before using in experiments. For neurosphere experiments, pups lacking Ncf1 and carrying the Gt(ROSA)26tdTomato transgene were generated by crossing B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J mice (The Jackson Laboratory) to Ncf1–/– mice, and then mating the heterozygote offspring. Igfbp2–/– mice40 were a kind gift from Dr. Clifford J. Rosen. Animals were typically group housed and maintained in 12-h light/dark cycle with set points at 73 degrees Fahrenheit and 50% humidity. Animals were randomly assigned to the control or treated groups throughout the study. Breeding and all mouse experiments were performed according to a protocol approved by the University of Iowa Institutional Animal Care and Use Committee (IACUC).
Primary cell cultures
Primary neurosphere cultures were established from postnatal forebrain as described41, with the following modifications. Mouse pups were decapitated at 1–2 days of age. Forebrains were dissected and triturated to a single-cell suspension with a glass pipette. Primary cells from each pup were cultured and propagated in serum-free medium (SFM) DMEM/F12 supplemented with EGF, FGF (Sigma), insulin, transferrin, sodium selenite (ITSS) (Roche) and B-27 supplement (Invitrogen). After neurospheres were established, they were collected, incubated in TrypLE (Invitrogen) for 15 min at 37 °C then triturated to a single-cell suspension using glass pipettes. Adult SVZ NSCs were prepared as described42, with the following modifications. 8–12-week-old mice were euthanized using a high dose isoflurane followed by cervical dislocation. The SVZ was dissected and triturated to a single-cell suspension with a glass pipette. Cells were strained through a 70 µm cell strainer. Primary cells from each mouse were cultured and propagated in the same SFM used with neonatal NSCs. Second- or third-passage cells were used in all experiments. NSCs from each pup or adult were grown separately and the number of replicates in all cell culture experiments represents the number of pups or adult animals used.
BrdU labeling of animals
Ten- to twelve-week-old mice received a single intraperitoneal injection of 5’-bromo 2’-deoxyuridine (BrdU 300 mg kg–1). They were sacrificed 24 h later, and the brains were dissected and immediately imbedded in optimal cutting temperature compound (OCT) (Tissue-Tek). Serial fresh-frozen sagittal sections (20 µm) were cut using a cryostat. Sections were kept at –80 °C until used.
Collection and analysis of cerebrospinal fluid (CSF)
CSF was collected as described43 and kept at −80 °C until used. A mouse Cystatin-C ELISA kit (Biovendor) was used according to the manufacturer’s instructions, with the following changes: 1 µl of each CSF sample was diluted 1:3000 in two steps (1:15 then 1:200) with the dilution solution provided in the kit; and the samples were incubated with primary antibody overnight at 4 °C. A standard curve was generated and used to calculate the Cystatin-C concentration of the CSF.
Measurement of endogenous reactive oxygen species (ROS) levels
In vivo ROS levels were measured using the ROS-sensitive dye hydroethidine (Invitrogen) as described44. Briefly, 12-week-old C57BL/6 or Ncf1–/– males received an intravenous injection of hydroethidine (10 mg kg–1, in PBS 1% DMSO). Five hours later, the mice underwent intracardiac perfusion with PBS followed by 4% paraformaldehyde in PBS. Parasagittal sections of 30 µm thickness were cut using a cryostat. Nuclei were counterstained with Hoechst and coverslips were applied. Slides from different groups were imaged immediately, in parallel. Quantification was performed by Metamorph software and at the same threshold.
Detection of cysteine S-Nitrosylation
In vivo cysteine S-Nitrosylation levels were measured using biotin derivatization as previously described45. Briefly, 20 µm parasagittal brain sections (every 20th) of 12-week-old C57BL/6, Ncf1–/–, or Igfbp2–/– mice were fixed in 4% paraformaldehyde in PBS and washed three times with PBS containing 0.4 mM EDTA and 40 µM neocuproine. Free thiol groups were then blocked with 40 mM N-ethylmaleimide (NEM) in PBS containing 0.4 mM EDTA, 0.04 mM neocuproine, and 2.5% SDS for 30 min. Sections were washed three times and then incubated with 1 mM sodium ascorbate in PBS for 15 min to reduce S-nitrosylated proteins. Newly reduced cysteine residues were then labeled with 0.1 mM N-(3-Maleimidopropionyl)biocytin (MPB) in PBS for 30 min. After washing, sections were incubated with DyLight 549-conjugated streptavidin (1:250, Jackson Immunoresearch Labs) for 30 min. Nuclei were counterstained with Hoechst 33342 and coverslips were mounted in Aquamount. Slides from different groups were stained and imaged, in parallel. Quantification was performed by Metamorph software at the same threshold for all images.
Immunofluorescence (IF)
Slides representing every twentieth section (at least 3 sections from each hemisphere), matching the parasagittal sections from all mice, were fixed in 4% PFA for 30 min at room temperature, washed 3 times in 1 x PBS, and boiled in 0.01 M sodium citrate buffer pH 6.0, for 25 min at 95–98 °C, for epitope retrieval. Sections were permeabilized in blocking solution (1 x PBS 20% donkey serum, 1 mM CaCl2, and 0.5% Triton-X 100). The slides were then incubated with primary antibody against BrdU (mouse, 1:250, BD Bioscience) diluted in diluent solution (1 x PBS containing 0.5% Triton-X 100, 1% donkey serum and 1 mM CaCl2, overnight at 4 °C). Subsequently, slides were washed 3 times for 10 min in 1 x PBS, and then incubated with Alexa Fluor 568-conjugated donkey anti-mouse IgG secondary antibody (Jackson Immunoresearch, 1:250) and diluted in the same solution for 2 h at room temperature. Slides were washed in 1 x PBS 3 times, for 10 min each. SlowFade Gold with DAPI (Invitrogen) was added and coverslips were applied. Immunofluorescence staining for γ-H2ax, Rad51, Nestin, NeuN, and O4 was done similarly with the exception that epitope retrieval was performed in a pressure cocker for 5 min for γ-H2ax, Rad51, and Nestin. Primary antibodies used were γ-H2ax (rabbit, 1:300, Abcam), Rad51 (mouse, 1:330, Abcam), and Nestin (chicken, 1:250, Novus Biologicals). Immunofluorescent NeuN and O4 staining was done without epitope retrieval using primary antibodies to NeuN (rabbit, 1:400, Abcam) and O4 (mouse, 1:440, Millipore).
Neurosphere formation and growth
Second-passage NSCs from each pup were seeded at clonal density (100 cells ml–1 of medium)9 in uncoated 24-well plates (Nunc). The cultures were monitored daily for neurosphere formation. After 11 days in culture in SFM, differential interface contrast (DIC) or DIC and red fluorescent protein (tdTomato) tiled scans of every well were acquired using the MetaMorph software (Molecular Devices) and a spinning-disk microscope DMI-60000 (Leica) equipped with an EMCCD camera (Hamamatsu). Cells were then harvested, triturated to a single-cell suspension, and counted using Countess (Invitrogen) according to the manufacturer’s protocol.
Immunofluorescence-based staining of neurospheres
Second-passage NSCs were seeded at clonal density (100 cells ml–1 of media) in glass-bottom 35 mm dishes (MatTek) coated with poly-d-lysine and laminin. Five days after plating, developing neurospheres remained attached to the plate. At this time, they were grown in differentiation medium (DMEM/F12 supplemented with fetal bovine serum (FBS) and IGF (Sigma)). After 11 days in differentiation medium, the differentiated progenitors were fixed in 4% PFA for 1 h at room temperature. Differentiated progenitors were then carefully washed 3 times in 1 x PBS, using a bulb pipette with a 200 µl pipette tip attached to its end to avoid detachment. Differentiated progenitors were then incubated first in blocking solution for 1 h at room temperature, and then with primary antibodies against the following antigens: β-Tubulin III (rabbit, 1:250, Sigma), O4 (mouse, 1:440, Millipore) and Gfap (chicken, 1:250, Aves Labs) in diluent solution, overnight at 4 °C. Excess primary antibody was washed off 3 times using 1 x PBS. Differentiated progenitors were then incubated with fluorophore-conjugated secondary antibodies in diluent solution for 2 h at room temperature. Excess secondary antibody was then washed off using 1x PBS (three washes of 10 min duration each). SlowFade Gold with DAPI (Invitrogen) was then applied.
Assessment of NSC proliferation and cell death
NSCs were seeded at density of 200,000 cells/2 ml onto poly-D-lysine coated 35 mm dishes with glass-bottom coverslips. NSCs were grown under proliferation conditions with Vinyl-L-NIO (L-VNIO, 100 µM) (Enzo Lifesciences) or vehicle for 3 days. 5-ethynyl-2’-deoxyuridine (EdU, 5 µM) was added to all dishes for 4 h before fixation in 4% paraformaldehyde. Cells were washed three time in PBS and then stained with the In-Situ Cell Death Detection Kit Fluorescein (Sigma) according to the manufacturer’s protocol. Cells were washed three times in PBS and Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (ThermoFisher Scientific) was used to detect EdU according to the manufacturer’s protocol. Cells were then washed and incubated with Hoechst 33342 for nuclear counterstain.
Oxidation and reduction of mouse recombinant Igfbp2 (mrIgfbp2)
MrIgfbp2 (R&D Systems) was incubated with 20 mM Dithiothreitol (DTT) for 30 min at 37 °C (Red), 1 mM H2O2 for 10 min at room temperature (Oxi) or with DTT for 30 min followed by H2O2 for 10 min (Red→Oxi). All incubations were performed under Argon and each incubation was followed by removal of excess DTT or H2O2 using Zeba spin desalting columns (ThermoFisher). DTT-, H2O2-, or DTT→H2O2-Pretreated mrIgfbp2 was then added to Ncf1–/– NSC cultures.
Assessment of Igfbp2 binding affinity to Igf1 and Igf2
Binding affinity studies were performed as previously described46 with the following modifications, 1 ng of native, reduced, or oxidized mouse rIgfbp2 was incubated with 10, 30, 100, or 300 ng/ml of Biotinylated rat rIgf2 or mouse rIgf1 (Eagle Bioscience) in a total volume of 500 µl of 50 mM Tris buffer containing 1% BSA pH 7.4 for 22 h at 4 °C. 100 µl of each reaction was added to an ELISA well coated with rat anti-Igfbp2 antibody (R & D Systems). Detection of Igfbp2-bound biotinylated Igfs was done using HRP-conjugated streptavidin followed by TMB. Uncoated wells, wells coated with rat anti-Igfbp2 but without the addition of the binding reaction, and coated wells with the addition of biotinylated Igfs without Igfbp2 were used as controls and for normalization. The experiment was performed twice with two replicates for each condition/experiment.
Collection of protein from NSC conditioned medium and LC-MS/MS secretome analysis
P2 NSCs from one WT and one Ncf1–/– pup were seeded at a density of 100,000 cells ml–1 in T-25 flasks (Thermo) and maintained under proliferation conditions for 5 days. Conditioned medium was collected, centrifuged, filtered (0.22 µm pores), and flash frozen in liquid nitrogen and stored at –80 °C. The concentration of protein in the conditioned medium was measured using the BCA Protein assay (ThermoFisher Scientific). Samples were lyophilized using a speed-vac, denatured, and solubilized in 50 µl of 8 M urea in 0.1 M triethyl ammonium bicarbonate (TEAB). Samples were then reduced in 10 mM dithiothreitol (DTT) for 1 h at 37 °C and alkylated in 55 mM iodoacetamide (IAA) for 1 h at room temperature in the dark. Alkylated proteins from WT and Ncf1–/– NSCs were then digested in trypsin MS grade at a 1:50 ratio overnight at 37 °C. Digested peptides were then desalted using C18 Microspin columns (Nest group). Digested peptides were run on LTQ Liquid chromatography mass spectrometer (Thermo). The resultant traces were searched against mouse IPI database using Mascot search engine for protein identification to generate mascot generic (mgf) files. Mgf files were then used in Scaffold (Proteome Software Inc., Portland, OR) to visualize and compare the secretomes from WT and Ncf1–/– NSCs.
Collection of protein from conditioned medium, preparation of total cell lysates, and western blot analysis
P2 NSCs from each pup were seeded at a density of 100,000 cells ml–1 in T-25 flasks (Thermo) and maintained under proliferation conditions for 5 days. Neurospheres suspended in conditioned medium were harvested in a 15 ml conical tube and centrifuged. Cell pellets were lysed in RIPA buffer (Sigma) supplemented with Pierce phosphatase inhibitor mini tablets (Pierce) and cOmplete protease inhibitor cocktail (Roche) on ice for 20 min and sonicated for 20 s. Lysates were centrifuged at 13,000 × g for 5 min at 4 °C. Supernatant was collected in screw capped 2 ml tubes, snap frozen in liquid nitrogen, and stored at –80 °C. Conditioned medium was further centrifuged and filtered (0.22 µm pores), snap frozen in liquid nitrogen, and stored at –80 °C. The concentration of protein in the conditioned medium was measured using the Bio-Rad Protein assay (Bio-Rad). For each sample, 150 µg of protein was loaded onto a 15% or 4–20% gradient SDS polyacrylamide gel after boiling in Laemmli buffer (Sigma). Protein bands were transferred to a nitrocellulose membrane, which was then blocked in 2% bovine serum albumin (BSA) in filtered 1 x TBS buffer (36 mM Tris Base, 50 mM NaCl and 0.5% Tween 20). The membrane was then incubated with rabbit polyclonal anti-Igfbp2 (Millipore, 1:1000), goat polyclonal anti-Igfbp2 (R & D systems, 1:500), rabbit monoclonal anti-γ-H2ax (Abcam, 1:1000), goat polyclonal anti-Gapdh (ThermoFisher, 1:1000), Rad51 (mouse, 1:1000, Abcam), Nestin (chicken, 1:750, Novus Biologicals), or mouse monoclonal anti-Flag (Sigma, 1:500) in 0.5% BSA in filtered 1 x TBS, overnight at 4 °C. The membrane was then washed and incubated in 0.5% BSA in filtered 1 x TBS containing IRDye 680 donkey-anti-rabbit, IRDye 800 donkey-anti-goat antibody (1:10,000, LI-COR Biosciences), Alexa Fluor 488-Conjugated Donkey anti-chicken (Jackson ImmunoResearch, 1:10,000), or HRP-Conjugated Donkey anti-mouse (Jackson ImmunoResearch, 1:10,000) for 2 h at room temperature. The membrane was then imaged using the Odyssey or Odyssey M imaging system (LI-CORE Biosciences). Densitometry was carried out using the Image Studio Lite software and Empiria Studio (LI-CORE Biosciences).
RNA sequencing and pathway analysis
Primary NSCs were prepared from 4 WT and 4 Ncf1–/– pups. P2 NSCs from each pup were seeded at a density of 100,000 cells ml–1 in T-25 flasks (Thermo) and maintained under proliferation conditions. At 48 h after plating, paired Ncf1–/– NSC cultures from each animal were treated with vehicle or Igfbp2 (60 ng ml–1). This concentration of Igfbp2 was calculated based on the abundance of Igfbp2 in the media of WT culture. Forty-eight hours later, total RNA was prepared. Samples were depleted of rRNA and RNAseq was performed on the remaining RNA by the Genomics Core at the University of Washington. Median quality for all bases was equivalent for all samples; the median Phred quality scores for each base was ≥32. Samples were mapped using the Bowtie2 software and quantified with RSEM47. All downstream analyses used transcripts per million (TPM) as units. One-way ANOVAs was performed using the aov function in R version 3.2.1. Tukey’s post hoc test was then performed for all genes using the TukeyHSD function. All p-values were then FDR corrected by the Benjamini–Hoeschberg (BH) correction using the p.adjust function in R. All subsets of genes were selected using the BH FDR corrected q-values, and cutoffs of 0.05. All heat maps were generated using the heatmap.2 function, using Euclidean distance from the gplots library in R. For heat map display, all genes were log transformed [log2(TPMi+1)] and then linear normalized [logTPMi − min(logTPM)]/[max(logTPM) − min(logTPM)]. The minimal and maximal values used were the minimum and maximum TPM for each gene. Biological pathway analysis was performed using Integrated Pathway Analysis software (Ingenuity Systems, Redwood City, CA) and the absolute-fold change in gene expression for the indicated comparisons. The positive pathway identification threshold was set to P < 0.05 by Fisher’s exact test. Ingenuity Pathway Analysis (IPA) software (Qiagen) was used to determine GO terms and calculate the differentially activated or inhibited pathways and biological functions in the Ncf1–/– transcriptomes compared to wild-type counterpart.
siRNA knockdown experiments
200,000 NSCs were plated into all wells of 6-well dishes and allowed to grow for 3 days prior to transfection with dicer substrate interfering RNA (dsiRNA). dsiRNA oligos were ordered from IDT, resuspended in 200 µl/nanomole Invitrogen ultrapure water, and used to transfect cells (with Lipofectamine RNAiMAX, Invitrogen). For each well in a 6-well dish, 5 µl of dsiRNA stock (25 nM final concentration) was mixed with 125 µl of OptiMEM, while separately 10 µl of Lipofectamine RNAiMAX was mixed with 125 µl OptiMEM; these fractions were then mixed and incubated at room temperature for 5 min, then added drop-wise to wells. The IDT NC1 dsiRNA was used as a negative control. Fanca, Fancd2, or Rad51 were knocked down using the following IDT dsiRNA kits: mm.Ri.Fanca.13.1, mm.Ri.Fancd2.13.1, or mm.Ri.Rad51.13.1.
Mouse Fanca (mfanca)-PiggyBac vector plasmid construction
NCBI gene number 14087 was used to synthesize mFanca gene flanked by XbaI at the 5’-end and NotI at the 3’-end inserted in pUC57 (Genscript). The mFanca gene fragment was subcloned into the XbaI and NotI restriction enzyme sites downstream of the CMV promoter in the PiggyBac vector plasmid, which also harbored a puromycin-resistant gene cassette (cat. # PB513B-1; SBI System Biosciences). A negative control PiggyBac vector containing GFP and puromycin-resistant gene expression cassettes was also generated.
Generating mFanca-overexpressing (Fanca OE) mouse NSCs
Passage 2 WT NSCs were transfected with Super piggyBac Transposase expression vector (Cat. # PB210PA-1; SBI System Biosciences) in addition to mFanca or GFP-expressing PiggyBac vector plasmid using the Lipofectamine LTX with Plus Reagent (Invitrogen). Transduced NSCs were selected in 3 µg ml–1 puromycin for 1 day.
Analysis of Igfbp2 cysteine oxidation
Two protocols were used for oxidation and reduction of redox-sensitive cysteine residues of Igfbp2. For oxidation, mrIgfbp2 (120 µg ml–1) was incubated with 0 µM, 10 µM, 100 µM, or 1 mM H2O2 at pH 7 for 10 min at room temperature. This treatment typically oxidizes the redox-sensitive thiol residues to form disulfide bonds. In this protocol, excess H2O2 was eliminated by incubation with catalase (0.1 µg ml–1) for 15 min at room temperature. For reduction, mrIgfbp2 (20 µM) was incubated with a 4 M excess of tris[2-carboxyethyl] phosphine (TCEP) (80 µM) in Sodium Citrate for 15 min at room temperature. This treatment permanently reduces all the oxidized redox-sensitive cysteine residues to thiol form. 1% Acetic acid was added to adjust the pH to 6.5. The results of both protocols were then incubated in N-(Biotinoyl)-N′-(iodoacetyl)ethylenediamine (BIAM) (100 µM) for 15 min at room temperature. This step typically labels all the available thiol groups with BIAM, which is detectable by WB and LC-MS/MS. Excess BIAM was quenched by adding β-Mercaptoethanol (BME) to a final concentration of 20 mM. The pH was adjusted to 8.5 using 1.2 M Tris base buffer. Subsequently, 6 µl of 6x Laemmli buffer were added to 30 µl of each reaction and the samples were boiled. Equal amounts of each reaction were subjected to SDS-PAGE and protein bands were transferred to a nitrocellulose membrane. Immunoblotting was then performed using IR 800-conjugated streptavidin. The rest of each reaction was submitted to the proteomics core at the University of Iowa Carver College of Medicine for LC-MS/MS analysis and evaluation of the BIAM-labeled cysteine residues of Igfbp2.
Generating mutant Igfbp2 plasmids
We used the pCMV-mIgfbp2 plasmid, which carries a Myc-DDK-tagged mouse Igfbp2 cDNA (NM_008342) (Origene). To generate the pCMV-Igfbp2C263A plasmid, a partial cDNA fragment of mouse Igfbp2 harboring the C263A mutation was synthesized (IDT, Coralville, IA) and exchanged into pCMV-mIgfbp2. To generate the pCMV-Igfbp2C43A and pCMV-Igfbp2C43/263A plasmids, we used the forward primer CGCTGCCCACCCGCCACGCCCGAGCG and reverse primer CGCTCGGGCGTGGCGGGTGGGCAGCG with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions.
Expression of WT and mutant mIgfbp2 in Igfbp2
–/– NSCs
Igfbp2–/– NSCs were harvested from newborn pups and 500,000 cells were plated onto each well of 6-well dishes. Cells were allowed to grow for 24 h prior to transfection with plasmids carrying the WT or mutant mouse Igfbp2 cDNA. Cells were transfected using the Lipofectamine LTX with Plus Reagent (Invitrogen). For each well in a 6-well dish, 5 µg of plasmid DNA stock was mixed with 150 µl of OptiMEM and 5 µl of Plus Reagent, while separately 12 µl of Lipofectamine LTX was mixed with 150 µl OptiMEM. These fractions were then mixed and incubated at room temperature for 5 min, then added drop-wise to wells. We used pCMV-Igfbp2 (Origene), pCMV-Igfbp2C43A, pCMV-Igfbp2C263A, or pCMV-Igfbp2C43/263A plasmids for transfections. pCMV6-eGFP plasmid was used as a negative control. Eighteen hours after the start of transfection, the medium was replaced with a mixture of fresh growth medium and conditioned medium at a ratio of 2:1.
Reverse transcription and quantitative polymerase chain reactions (rtPCR and qPCR)
P3 Igfbp2–/– NSCs were plated onto all wells of 6-well dishes. Three days after transfection with the indicated plasmids, 200 µl of conditioned medium were collected for western analysis, to ensure that WT and mutant Igfbp2 were expressed and secreted. After a further 48 h, the cells were harvested, and total RNA was prepared using the RNeasy Plus Mini Kit (Qiagen). cDNA was prepared from the total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or SuperScript IV VILO Master Mix (ThermoFisher Scientific) according to the manufacturer’s protocol. Quantification of transcription levels relative to β-Actin (inner control) was performed using TaqMan Universal Master Mix II, with UNG (Applied Biosystems), according to the manufacturer’s protocol and utilizing the following gene expression assays: Mm02619580_g1 Actb 4448484 TaqMan Gene Expression Assay, SM VIC PL for β-Actin, Mm01243365_m1 Fanca 4331182 TaqMan Gene Expression Assay, SM for Fanca, Mm01184611_m1 Fancd2 4331182 TaqMan Gene Expression Assay, SM for Fancd2 and Mm00487905_m1 Rad51 4331182 TaqMan Gene Expression Assay, SM for Rad51.
Imaging and image processing
All immunofluorescence (IF) images were acquired using a laser scanning confocal microscope LSM-700 (Zeiss; ×20 objective), LSM-880 (Zeiss, ×20 and ×63 objectives), and LSM-980 (Zeiss, ×20 and ×63 objectives) in conjunction with the acquisition software Zen-2010. Tiled scans of the areas of interest in the mouse brain and of all neurospheres in the glass-bottom well of a 35-mm plate were acquired. Image processing and quantification were performed using offline MetaMorph software (Molecular Devices). Quantification of the numbers of cells positive and negative for specific markers or a thymidine analog was carried out using the multi-wavelength cell scoring application module of the MetaMorph software. This module allowed for the following parameters to be set: the average size of the nucleus and cytosol; whether a marker is expressed in the nucleus, cytosol, or both; and the intensity above local background and the percentage of the cell that must be stained for it to be considered positive for a certain marker. All bright field (BF) images were captured using spinning disc DMI 6000 (Leica, ×2.5, ×10, and ×20 objectives) in conjunction with the acquisition software online MetaMorph. Tiled scans of the whole wells or flasks were acquired. Image processing and quantification of neurosphere number and dimensions were performed using offline MetaMorph software.
Statistical analysis
Unless otherwise specified, statistical analysis and the calculation of significance values were performed using the Prism 7 (GraphPad) software. The two-tailed Mann–Whitney U test, two-tailed student’s t-test, as well as Kruskal–Wallis, one-way and two-way ANOVA, were used when appropriate. The Bonferroni or Benjamini–Hochberg FDR post-test comparing all groups was used where indicated; significance was considered at p < 0.05. Exact p values and details of each statistical test are available in the accompanying Source data file. Error bars indicate s.e.m. All bar graphs were assembled using Excel (Office 365).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
I have been writing professionally for over 20 years and have a deep understanding of the psychological and emotional elements that affect people. I’m an experienced ghostwriter and editor, as well as an award-winning author of five novels.